Rosalind: RNA

Welcome to my Rosalind tutorial on RNA

The basic idea of RNA is to convert a given string of DNA into its RNA counterpart. This basically involves regurgitating the given string only replacing the “T” or Thymine with a “U” or Uramine counterpart.

Given Problem

Given: A DNA string having length at most 1000 nt.
Return: The transcribed RNA string of t
. Input : GATGGAACTTGACTACGTAAATT
Output : GAUGGAACUUGACUACGUAAAUU

As you can see in the input/output file, this problem simply requires changing all fo the “T’s” into”’U’s”

Source Code

def runRna(inputFile):
    fi = open(inputFile, 'r') #reads in the file that list the before/after file names
    activityFile = fi.read() #reads in files
    finalString = ""

    for k in activityFile:
            if k =="T":
                    finalString = finalString + "U"
            else:
                    finalString = finalString + k
    return finalString

The first four lines have already been explined in my earlier tutorial, but essentially they involve inportint the name of the input file and then reading in the entire inputFile as a single line.

DNA to RNA for loop

for k in activityFile:
            if k =="T":
                    finalString = finalString + "U"
            else:
                    finalString = finalString + k
    return finalString

This is the heart of the code and the process shown here is really quite simple. You run through the code and if you come across a “T” you instead send in a “U”. If the nucleotide is not a “T” then you just report the same nucleotide.

return finalString

At the end of this, you return the newly created RNA string to the source.

Thats the end of RNA, Its really not that complicated but I wanted to make sure to go over every bit of code in this tutorial. Make sure to send me any questions that you may have about this code or tutorial!